Skip to main content

Table 1 Retrotransposition events associated with human disease

From: Roles for retrotransposon insertions in human disease

  Insertion Gene CHR Reference Disease Subfamily Size polyA tail length Truncation Transduction (bp) Strand Exon/Intron/Mechanism Target-site duplication (TSD) L1 EN site (5′-TTTT/AA-3′) Note
1 Alu ABCD1 X Kutsche et al. 2002 [255] ALD AluYb9 98 20 Y/5′TR N S 4.7 kb Deletion No TSD ATTT/GT  
2 Alu ATP7A X Gu et al. 2007 [256] Menkes Disease AluYa5a2 282 89 N N AS E AAAAAGGACAGC TTTT/AT  
3 Alu BTK X Lester et al. 1997 [257] XLA AluY N/A N/A N/A N AS E N/A N/A  
4 Alu BTK X Conley et al. 2005 [258] XLA AluY 281 74 N N S E AGAAATGTATGAGTAAGT TTCT/AT Same insertion site Conley et al. SVA
5 Alu CD40LG X Apoil et al. 2007 [259] HIGM AluYb8 292 8 N N AS E AAAAATTTTC TTTT/AT  
6 Alu CLCN5 X Claverie-Martin et. al. 2003 [260] Dent’s Disease AluYa5 281 50 N N S E AGAAAATGCTCGAAAGA TTCT/AT  
7 Alu CTRC 1 Masson et. al. 2013 [160] Chronic pancreatitis Alu 31 11 Y/5′TR N AS 53.9 kb Deletion N/A TCTT/AT Deletes entire CTRC and ELA2A genes
8 Alu PKLR 1 Lesmana et. al. 2015 [159] Severe Hereditary Nonspherocytic Hemolytic Anemia Yb8 288 70 N N S E AAGATCATCAGCAAA TCTT/GA consanguinity, consensus Yb8
9 Alu FVIII X Sukarova et. al. 2001 [261] Hemophilia A AluYb8 290 47 N N AS 3 nt Deletion No TSD TTTC/AT  
10 Alu FVIII X Ganguly et. al. 2003 [262] Hemophilia A AluYb9 288 37 N N AS I/Splicing AAAAACCAACAGG TTTT/AT Consensus Yb9
11 Alu FVIII X Green et. al. 2008 [263] Hemophilia A AluYb8 FL N/A N N AS E N/A   
12 Alu FIX X Vidaud et al. 1993 [264] Hemophilia B AluYa5a2 244 78 Y/5′TR N S E AAGAATGGCAGATGCGA TCTT/AA Same insertion site as Wulff et al. Alu
13 Alu FIX X Wulff et al. 2000 [265] Hemophilia B AluYa5a2 237 39 Y/5′TR N S E AAGAATGGCAGATGC TCTT/AA Same insertion site as Vidaud et al. Alu
14 Alu FIX X Li et al. 2001 [266] Hemophilia B AluY 279 40 Y/5′TR N AS E AAGAAACTGGTCCC TCTT/AA  
15 Alu GK X Zhang et al. 2000 [267] GKD AluYc1 241 74 Y/5′TR N AS I AAAAAATAAG TTTT/AA  
16 Alu IL2RG X Lester et al. 1997 [257] XSCID AluYa5 N/A N/A N/A N AS I N/A N/A  
17 Alu CRB1 1 den Hollander et al. 1999 [268] RP AluY 244 70 Y/5′TR N AS E AAGAGTAAAGATGA TCTT/GA  
18 Alu SERPINC1 1 Beauchamp et al. 2000 [269] Type 1 ATP Alu 6 40 Y/5′TR N AS 1.4 kb Deletion N/A TTCT/AT Shortest Alu insertion
19 Alu ALMS1 2 Taşkesen et al. 2012 [270] Alström syndrome AluYa5 257 76 Y/5′TR N S E AAAAGCCTAGAGAA TTTT/AA  
20 Alu MSH2 2 Kloor et al. 2004 [271] HNPCC AluJ 85 40 Y/5′TR N S E N/A N/A Contains extra 99 nt 3′-of Alu, may be transduction or recombination
21 Alu MSH2 2 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
22 Alu ZFHX1B 2 Ishihara et al. 2004 [272] MWS AluYa5 281 93 N N S E AAAATTAAAACA TTTT/AA  
23 Alu BCHE 3 Muratani et al. 1991 [273] Cholinesterase deficiency AluYb9 289 38 N N S E AAAAATATTTTTTCC TTTT/AA  
24 Alu CASR 3 Janicic et al. 1995 [274] FHH and NSHPT AluYa5 280 93 N N AS E GAAAGCGTGAGCTGC TTTC/AA  
25 Alu HESX1 3 Sobrier et al. 2005 [275] Anterior Pituitary Aplasia AluYb8 288 30 N N S E AGAAAATGTCTTTAGA TTCT/AA  
26 Alu OPA1 3 Gallus et al. 2010 [276] ADOA AluYb8 289 25 N N AS I/Splicing AAAAATTTTAAAAAGTT TTTT/AC  
27 Alu MLVI2 5 Economou-Pachnis and Tsichlis 1985 [277] Associated with leukemia AluYa5 280 26 N N AS I GAAAATGT TTTC/AT  
28 Alu APC 5 Halling et al. 1999 [278] Hereditary desmoid disease AluYb8 278 40 Y/5′TR N S E AAGAATAATG TCTT/AA Same insertion site as Miki et al. L1
29 Alu APC 5 Su et al. 2000 [279] FAP AluYb9 93 60 Y/5′TR N AS I/Splicing No TSD TTTT/AA 1.6 kb intronic deletion
30 Alu APC 5 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
31 Alu MAK 6 Tucker et al. 2011 [280], Edwin Stone, personal communication RP AluYb8 281 57 N N AS E AAAGAAAAAA CTTT/AA Identified by exome resequence
32 Alu NT5C3 7 Manco et al. 2006 [281], Leticia Ribeiro, personal communication Chronic hemolytic anemia Alu Ya5 281 36 N N S E AAGAATGGCAGATGG TCTT/AA  
33 Alu CFTR 7 Chen et al. 2008 [282] Cystic Fibrosis AluY 46 57 Y/5′TR N AS E AAGAATCCCACCTATAAT TCTT/AA  
34 Alu CFTR 7 Chen et al. 2008 [282] Cystic Fibrosis AluYa5 281 56 N N S E AATAGAAATGATTTTTGTC TCTC/AT 3′-Processing of (5′-CTC-3′)
35 Alu EYA1 8 Abdelhak et al. 1997 [283] BOR syndrome AluYa5 n/a 97,31 N/A N AS E AAAAAATAAATGTGTG TTTT/AA PolyA tail shortening between generations
36 Alu LPL 8 Okubo et al. 2007 [284] LPL deficiency AluYb9 150 60 Y/5′TR N AS 2.2 kb Deletion No TSD TTTT/AA  
37 Alu CHD7 8 Udaka et al. 2007 [285] CHARGE syndrome AluYa5/8 75 100 Y/5′TR N S 10 kb Deletion No TSD ATTT/AA  
38 Alu POMT1 9 Bouchet et al. 2007 [286] Walker Warburg syndrome AluYa5 290 53 N N AS E AAAAAGAGATGTACTG TTTT/AC  
39 Alu FGFR2 10 Oldridge et al. 1999 [287] Apert syndrome AluYa5 283 69 N N AS I/Splicing AGAAAACAAGGGAAGCA TTCT/AG  
40 Alu FGFR2 10 Oldridge et al. 1999 [287] Apert syndrome AluYb8 288 47 N N AS E AGAATTACCCGCCAAG TTCT/AT  
41 Alu FGFR2 10 Bochukova et al. 2009 [288] Apert syndrome AluYk13 214 12 Y/5′TR N AS E AAAAGTTACATTCCG TTTT/GA  
42 Alu FAS 10 Tighe et al. 2002 [289] ALPS AluYa5 281 33 N N AS I AGAATATTCTAAATGTG TTCT/AA  
43 Alu SERPING1 11 Stoppa-Lyonnet et al. 1990 [290] HAE AluYc1 285 42 N N S I AAAAATACAAAAATTAG TTTT/AG  
44 Alu HMBS 11 Mustajoki et al. 1999 [291] AIP AluYa5 279 39 N N AS E AAGAATCTTGTCCC TCTT/GA  
45 Alu ATM 11 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
46 Alu GNPTAB 12 Tappino et al. 2008 [292] ML II AluYa5 279 17 N N AS E AAAAACAACAACTGAG TTTT/GA  
47 Alu BRCA2 13 Miki et al. 1996 [293] Breast Cancer AluYc1 281 62 N N S E AATCACAGGC GATT/AT  
48 Alu BRCA2 13 Teugels et al. 2005 [294] Breast Cancer AluYa5 285 N/A N N S E AAGAATCTGAACAT TTCT/GC 3′ Processing 2 nt (5′-CT-3′)
49 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
50 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
51 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
52 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
53 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
54 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
55 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
56 Alu BRCA2 13 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
57 Alu PMM2 16 Schollen et al. 2007 [295] CDG-Ia AluYb8 263 10 Y/5′TR N AS 28 kb Deletion No TSD TTTT/AA  
58 Alu PALB2 16 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
59 Alu BRCA1 17 Peixoto et al. 2013 [161] Breast and Ovarian Cancer Family AluYc 191 60 Y/5′TR N AS 23.3 kb Deletion No TSD CTTT/AG  
60 Alu BRCA1 17 Teugels et al. 2005 [294] Breast Cancer AluS 286 N/A N N S E GAAAAAGAATCTGCTTT TTTC/GA  
61 Alu BRCA1 17 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
62 Alu NF1 17 Wallace et al. 1991 [23] NF1 AluYa5 282 40 N N AS I/Splicing AAAAAAAAAAACAT TTTT/AA First report of de novo Alu insertion
63 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluY 280 N/A N N S I AAAAAATTCAG TTTT/AA Same insertion site as Wimmer et al.a
64 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluY 281 N/A N/A N AS I N/A   
65 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYa5 282 60 N N S E ATAAATAGCCTGGA TTAT/AA  
66 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYa5 284 120 N N AS E AAAAAACTTGCT TTTT/GA Same insertion site as Wimmer et al.c
67 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYa5 281 N/A N N AS E AAAAAACTTGCTGATGG TTTT/GA Same insertion site as Wimmer et al.c
68 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYa5 284 110 N N AS E AATAAAACCTAAAGA TATT/GA  
69 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYa5 279 N/A N N S E AAAAGAAGAACATAT TTTT/GT Same insertion site as Wimmer et al.b
70 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYa5 264 60-85 Y/5′TR N AS E AAGAAGTGCGGTACCT TCTT/GA  
71 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYb8 249 121 Y/5′TR N S E AAAGCAGTGC CTTT/AT  
72 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYb8 288 N/A N N AS I AAAAAAGAGAAAGACAA TTTT/AA Same insertion site as Wimmer et al.a
73 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYb8 289 120 N N AS E AACAATGGTCTT TGTT/AA  
74 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYb8 288 78-178 N N S E AAACAATGATGTTA TTTC/AA 3′ Processing of 1 nt (C)
75 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYb8 288 118 N N S E AAAAGAAGAACATAT TTTT/GT Same insertion site as Wimmer et al.b
76 Alu NF1 17 Wimmer et al. 2011 [296] NF1 AluYb8 268 121 Y/5′TR N AS I AAAAAACAAACAAACA TTTT/GT  
77 L1 CYBB X Meischl et al. 1998 [297], Brouha et al. 2002 [181] CGD L1 Ta 1722 101 Y/5′TR Y (280) S E AA TGTT/GA Maternal Meiosis I
78 L1 CYBB X Meischl et al. 2000 [298] CGD L1 Ta 836 69 Y/5′TR/INV N S I/Splicing AGAAATAACTATTTAA TTCT/AA  
79 L1 CHM X van den Hurk et al. 2003 [177] Choroideremia L1 Ta 6017 71 FL Y (119/406) AS E AGAAGATCAATTAG TTCT/AA Insertion in Early Development
80 L1 DMD X Musova et al. 2006 [299] DMD L1 Ta 452 41 Y/5′TR/INV N AS E AAATATCTTTATATCA ATTT/AA  
81 L1 DMD X Narita et al. 1993 [164] DMD L1 Ta 608 16 Y/5′TR N AS E No TSD TCTT/AA 2 nt deletion
82 L1 DMD X Holmes et al. 1994 [176] DMD L1 Ta 1400 38 Y/5′TR/INV Y(489) S E AAATCATCTGCTGCT ATTT/AA First Report of L1 3′TR
83 L1 DMD X Yoshida et al. 1998 [300] XLDCM L1 Ta 530 73 Y/5′TR N AS 5′-UTR/Loss of mRNA AAAAAAAACCTGGTAAA TTTT/AT Tissue specific loss of mRNA
84 L1 DMD X E Bakker & G van Omenn, personal communication DMD N/A 878 N/A Y/5′TR N S N/A N/A N/A  
85 L1 DMD X Awano et al. 2010 [301], Solyom et al. 2011 [302] DMD L1 Ta 212 118 Y/5′TR Y (212) AS E GAA TTTC/AA Orphan 3′-transduction
86 L1 FVIII X Kazazian et al. 1988 [22] Hemophilia A L1 Ta 3800 54 Y/5′TR N S E AAAGACAAACAAAAC CTTT/AA First report of de novo L1 insertion
87 L1 FVIII X Kazazian et al. 1988 [22] Hemophilia A L1 preTa 2300 77 Y/5′TR/INV N AS E AATGTTTCCTTCTTTTC CATT/AA  
88 L1 FIX X Li et al. 2001 [266] Hemophilia B L1 Ta 463 68 Y/5′TR N S E AAAAATAGTGCTGATA TTTT/AC  
89 L1 FIX X Mukherjee et al. 2004 [303] Hemophilia B L1 Ta 163 125 Y/5′TR N S E GAAAAATGGATTGT TTTC/AT  
90 L1 RP2 X Schwahn et al. 1998 [304] XLRP L1 Ta 6000 64 FL N S I/Loss of mRNA AAGACTGTAAGGTG TCTT/AA Interrupted polyA
91 L1 RPS6KA3 X Martinez-Garay et al. 2003 [305] Coffin-Lowry syndrome L1 Hs 2800 Yes Y/5′TR/INV N AS E AAGAAAACCTGCATTT TCTT/AG  
92 L1 ABDH5 3 Samuelov et al. 2011 [306], Eli Sprecher, personal communication CDS N/A FL N/A N N/A N I/Splicing N/A N/A  
93 L1 MLH1 3 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
94 L1 MLH1 3 Qian et al. 2015 [158] Hereditary Cancer N/A N/A N/A N/A N/A N/A E N/A N/A Pan-cancer panel testing
95 L1 APC 5 Miki et al. 1992 [200] Colon cancer L1Ta 520 222 Y/5′TR/INV N S E AAGAATAATG TCTT/AA Somatic Insertion/same insertion site as Halling et al. Alu
96 L1 EYA1 8 Morisada et al. 2010 [247] BOR syndrome L1 Hs 3756 None Y/3′TR N AS 17 kb Deletion No TSD TCTC/AG Internal Priming
97 L1 FKTN 9 Kondo-Iida et al. 1999 [307] FCMD L1Ta 1200 59 Y/5′TR N S I/Splicing/6 nt Deletion No TSD TTTT/AA  
98 L1 SETX 9 Bernard et al. 2009 [308], Christine Zühlke, personal communication AOA2 L1 Hs 1300 42 Y/5′TR/INV N S E GGAAGAATGTGAACTGGCTA TTCC/AG 3′-processing 2 nt (5′-CC-3′)
99 L1 PTEN 10 Helman et al. 2014 [201] endometrial carcinoma L1 Hs 90 22 Y/5′TR N S E AAAGAATCATCTGGATTATAG CTTT/AA Somatic Insertion
100 L1 HBB 11 Divoky et al. 1996 [309] β-thalassemia L1 Ta 6000 107 FL N AS I AAAATAAAAGCAGA TTTT/AT  
101 L1 PDHX 11 Mine et al. 2007 [310] PDHc deficiency L1 Hs 6086 67 FL N S 46 kb Deletion No TSD TTTT/AT  
102 L1 SLCO1B3 12 Kagawa et al. 2015 [157] Rotor syndrome L1 Ta-1d 5989 100 Near FL N S I/Splicing AAGAATTAATAGTGACAGT TCTT/AC 0.054 Japanese Allele Frequency, may be “Hot L1”
103 L1 RB1 13 Rodriguez-Martin et al.2016 [202] Familial Retinoblastoma L1 Ta-1d 6044 33 FL N S I/Splicing AAATTATCTGTTTC ATTT/AA N/A
104 L1 NF1 17 Wimmer et al. 2011 [296] NF1 L1 preTa 1800 N/A Y/5′TR N S E AAAAACGAAACTGTGT TTTT/AT Untemplated 3′- T?
105 L1 NF1 17 Wimmer et al. 2011 [296] NF1 L1 Ta 6000 N/A FL N S E AAAAATCGAGGG TTTT/AA Untemplated 3′- T?
106 L1 NF1 17 Wimmer et al. 2011 [296] NF1 N/A 2200 N/A Y/5′TR/INV N AS I/Splicing AAGAAAATGGT TCTT/AA  
107 SVA BTK X Rohrer et al. 1999 [311], Conley et al. 2005 [258] XLA N/A 251 92 Y/5′TR N S E AGAAATGTATGAGTAA TTCT/AT Same insertion site as Conley et. al. Alu
108 SVA TAF1 X Makino et al. 2007 [312] XDP F 2627 62 FL N AS I AAAAAAAAAAAATGAAATAG TCCT/AT 3′-Processing 3 nt (5′-CCT-3′)
109 SVA FIX X Nakamura et.al. 2015 [156] Hemophilia B F 2524 28 FL N AS E AAATGGCACTAGAA TTCC/AT 3′-Processing 1 nt (5′-C-3′)
110 SVA LDRAP1 1 Wilund et al. 2002 [313] ARH E 2600 57 FL N S I/Splicing GAAACCTGTTTTCTC TTTC/AA  
111 SVA SPTA1 1 Hassoun et al. 1994 [314], Ostertag et al. 2003 [24] HE and HPP E 632 50 Y/5′TR/INV Y (183/599) S E GAAATTTGAAGACTTCCAAGT TTTC/AA Orphan 3′-transduction
112 SVA CASP8 2 Stacey et al. 2016 [203] Breast Cancer Susceptibility E 2782 N/A FL N AS I/Decreased RNA AAGAATTTGA TCTT/AT Protective against prostate cancer; active locus?
113 SVA A4GNT 3 Nazaryan et al. 2015 [155] Chromothripsis E 502 None Y/5′TR (VNTR) N AS I N/A TTTT/GA First report of large scale rearrangement and an insertion. Implicates retrotransposition in germline chromothripsis.
114 SVA HLA-A 6 Takasu et al. 2007 [315] Leukemia F1 2000 45 FL N/A AS 14 kb Deletion N/A CCTT/AG Novel SVA subfamily (F1)
115 SVA PMS2 7 van der Klift et al. 2012 [154] Lynch syndrome F 2200 64 Y/5′TR (VNTR) N S I/Splicing AAGAATGTGCCATGTGA TCTT/AA SVA exonization
116 SVA FKTN 9 Kobayashi et al. 1998 [162] FCMD E 3023 32 FL N S 3′UTR/Splicing AAGAAAAAAAAAATTGT TCTT/AA  
117 SVA PNPLA2 11 Akman et al. 2010 [316] NLSDM E 1800 44 Y/5′TR N S E AAAGAGGCCCGG CTTT/AG  
118 SVA SUZ1P 17 Vogt et al. 2014 [153] NF1 F1 1700 23 Y/5′TR (VNTR) Y (282/160) AS I/Deletion of NF1 N/A TTTT/AC Largest reported insertion associated deletion (~1 Mb), somatic
119 SVA SUZ1P 17 Vogt et al. 2014 [153] NF1 F 1300 40 Y/5′TR (VNTR) N AS I/Deletion of NF1 N/A CTTT/AC 867 kb deletion, somatic
120 Processed Pseudogene CYBB X de Boer et al. 2014 [152] CGD N/A 5739 100 FL No AS I/Splicing AAAACTCAAAGACTC TTTT/AA First reported de novo processed pseudogene (TMF1)
121 pA COL4A6 X Segal et al. 1999 [317] Alport syndrome N/A N/A 70 N/A N/A AS 13.4 kb Deletion No TSD TTCT/AT  
122 pA AGA 4 Jalanko et al. 1995 [318] AGU N/A N/A 37 N/A N/A AS 2 kb Deletion No TSD TTCT/AA  
123 pA BRCA2 13 Wang et al. 2001 [319] Breast Cancer N/A N/A 35 N/A N/A S 6.2 kb Deletion No TSD TTCT/AA  
124 pA NF1 17 Wimmer et al. 2011 [296] NF1 N/A 130 120 N/A N/A AS E AAGAAA TCTTNAA  
  1. Data for this table were compiled from the primary references listed and reports prior to 2009 are reviewed in the following: Ostertag and Kazazian 2001 [35], Chen et al. 2006 [150], Belancio et al. 2008 [151], Hancks and Kazazian 2012 [86]
  2. A few insertions were left off the list as they were common polymorphisms or did not cause disease. The following websites and databases were used in the analysis: http://www.repeatmasker.org/, Repbase (http://www.girinst.org/), http://dbrip.brocku.ca/, The following symbols, a,b,c, indicate same insertion site in Wimmer et al. [296]
  3. Abbreviations: TR truncation, INV inversion, E exon, FL full-length, I intron
  4. Disease acronyms: ADOA Autosomal dominant optic atrophy, AGU Aspartylglucosaminuria, AIP Acute intermittent porphyria, ALD Adrenoleukodystrophy, ALPS Autoimmune lymphoproliferative syndrome, AOA2 Ataxia with oculomotor apraxia 2, ARH Autosomal recessive hypercholesterolemia, BOR Branchio-oto-renal syndrome, CDG-Ia Congenital disorders of glycosylation type Ia, CDS Chanarin-Dorfman syndrome, CGD Chronic granulomatous disease, DMD Duchenne muscular dystrophy, FAP Familial adenomatous polyposis, FCMD Fukuyama-type congenital muscular dystrophy, FHH and NSHPT Familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism, GKD Glycerol kinase deficiency, HAE Hereditary form of angioedema, HE and HPP Hereditary elliptocytosis and hereditary pyropoikilocytosis, HIGM Hyper-immunoglobulin M syndrome, HNPCC Hereditary non-polyposis colorectal cancer syndrome, LPL Lipoprotein lipase, MLII Mucolipidosis Type II, MWS Mowat-Wilson syndrome, NF1 Neurofibromatosis Type I, PDHc Pyruvate dehydrogenase complex deficiency, NLSDM Neutral lipid storage disease with subclinical myopathy, RP Retinitis pigmentosa, Type 1 ATP Type 1 antithrombin deficiency, XDP X-linked dystonia-parkinsonism, XLA X-linked agammaglobulinemia, XLDCM X-linked dilated cardiomyopathy, XLRP X-linked retinitis pigmentosa, XSCID X-linked severe combined immunodeficiency