Skip to main content

Table 2 Terminal Inverted Repeats (TIRs) of BrickBuilt elements from strain ATCC 33277. Terminal Inverted Repeats and family of selected IS and MITE-like elements in Porphyromonas gingivalis as well as ISNme1 from Neisseria meningitidis

From: Identification and characterization of a minisatellite contained within a novel miniature inverted-repeat transposable element (MITE) of Porphyromonas gingivalis

Locus (33277) TIR 5′ (nt) TIR 3′ (nt) Both TIRs
 BrickBuilt_1   CCGAAAGGTCTC  
 BrickBuilt_2   CCGAAAGGTCTC  
 BrickBuilt_3 AAGACCTTTGCA CCGAAAGGTCTC YES
 BrickBuilt_4 GAGACCTTTGCA TGCAAAGGTCTC YES
 BrickBuilt_5 GAGACCTTTGCA CGCAAAGGTCTC YES
 BrickBuilt_6   CACAAAGGTCTT  
 BrickBuilt_7    
 BrickBuilt_8   TGCAAAAGTCTC  
 BrickBuilt_9    
 BrickBuilt_10    
 BrickBuilt_11    
 BrickBuilt_12   GACAAAGGTCTC  
 BrickBuilt_13    
 BrickBuilt_14    
 BrickBuilt_15 GAGCCCTTTGCA   
 BrickBuilt_16    
 BrickBuilt_17 GAGCCCTTCGCA   
 BrickBuilt_18 GAGCCCTTTGCA TGCAAAGGCCTC YES
 BrickBuilt_19 GAGCCCTTTGCA   
Element Left TIR Right TIR Family
 ISPg1 GAGACCATTGCA TTCAAAGGTCTC IS5
 ISPg3 ACGTCAGTTCGA TCGAACTGACGT IS5
 ISPg4 GAGACTGTTGCA CGCAACAGTCTC IS5
 ISPg9 GAGACCATTGCA   IS5
 MITE239 ACGTGAGTTCGATATAAAGGAA TTCGCTTAAATCGAACTGGCGT  
 MITEPgRS/MITE464 GAGACTGTTGCA TGCAACGGTCTC  
 MITE700 ACGTCATTCGA TCGAACTCACGT  
 BrickBuilt GAGACCTTCGCA TGAAAGGTCTC  
 Nsm ISNme1 GAGACCTTTGCAAAA TTTTGCAAAGGTCTC IS5
  1. Blank spaces for TIRs indicate situations in which the region is degenerate or not present