Skip to main content

Table 4 List and DNA sequences of constitutive promoters

From: Compensating for over-production inhibition of the Hsmar1 transposon in Escherichia coli using a series of constitutive promoters

Promoter nameSequenceRelative mRNAAverage promoter metric
pEECTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACCATATGn.d.n.d.
p2 (00)CAATTCCGACGTCTAAGGAAACCATTATCATGACATCAACCTATAAAAATAGGCGTATCACGAGGCCCTCTCGTCTCCACCTCAAGCTCCCTATCTAGTGATAGCGATTGACATCCCTATCAGTGACGGAGATATTGAGCACATCAGCAGGACGCACTGACCACTTTAAGAAGGAGATATACATATG0.0030
p3 (JJ)CAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACCTCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCACTTTAAGAAGGAGATATACATATG0.1590.123911
p4 (K)CAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTCTCGTCTTCACCTCGAGTCCCTATCAGTGATAGGGATTGACATCCCTATCAGTGATAGAGACACTGGGCACATCAGCAGGACGCACTGACCACTTTAAGAAGGAGATATACATATG0.2990.274103
p5 (E)CAATTCCGACGCCTAAGAAACCATTATTATCATGACATTAGCCTATAAAAATAGGCGTACCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACACCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCACTTTAAGAAGGAGATATACATATG0.7430.83686
p6 (PLTet-O1)CAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCACTTTAAGAAGGAGATATACATATG10.868513
  1. Nomenclature (the letters indicated between brackets), sequence, relative mRNA and average promoter metrics of the constitutive promoters used in this study are from [32]. n.d.: not determined