Skip to main content

Table 2 Oligos and primers used in this study

From: Integrated Mobile Element Scanning (ME-Scan) method for identifying multiple types of polymorphic mobile element insertions

DescriptionSequence (5′- > 3′)
Long adaptor with indexesCAAGCAGAAGACGGCATACGAGATIndex1GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTIndex2*T
Short adaptor with indexesIndex2AGATCGGAAGAGCGTCGTG
1st round AluYb amplification primer/5Biosg/CAGGCCGGACTGCGGA*C
2nd round AluYb amplification primerAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNAGTGCTGGGATTACAGGCGTG*A
1st round L1HS amplification primer/5Biosg/GGGAGATATACCTAATGCTAGATGACAC*A
 /5Biosg/GGGAGATATACCTAATGCTAGATGACAC*G
 /5Biosg/GGGAGATATACCTAATGCTAGATGACAA*G
2nd round L1HS amplification primerTGCACATGTACCCTAAAACTTAGAGTATAA*T
1st round SVA amplification primer/5Biosg/AGAATCAGGCAGGGAGGTT*G
2nd round SVA amplification primerAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNAGTACMGTCCAGCTTCGGC*T
P7 adaptor amplification primerCAAGCAGAAGACGGCATACGAGA*T
L1_1 internal primer for validationGGGAGATATACCTAATGCTAGATGACA
L1_2 internal primer for validationTGCACATGTACCCTAAAACTTAG
SVA_1 internal primer for validationAGAATCAGGCAGGGAGGTTG
SVA_2 internal primer for validationAGTACMGTCCAGCTTCGGCT
/5Biosg/: 5′ Biotin; *: 3′ Phosphorothioate bond; Index1 and Index2: individual specific 6 bp indexes.