Skip to main content

Advertisement

Table 3 Oligonucleotide primers used in the study

From: Features of a novel protein, rusticalin, from the ascidian Styela rustica reveal ancestral horizontal gene transfer event

  Primer Sequence 5′-3′
1 Sr_P26_3’_F1 ggnaaywsntayathmng
2 Sr_P26_3’_F2 tasttayattcgttgt
3 Sr_P26_5’_R1 cattgtgccaagttcccgag
4 Sr_P26_5’_R2 ccgagcaatggttgctgttta
  1. h = a,c,t; y = c,t; s = c,g; n = a,g,c,t; m = a,c; w = a,t. Bold letters with underscore – overlaying parts of nested primers