Skip to main content

Table 2 Primers for amplification of specific chromoviral domains, LTR sequences and integration sites

From: Highly diverse chromoviruses of Beta vulgaris are classified by chromodomains and chromosomal integration

Amplified domain Probe number Forward primer Reverse primer Length (bp)
Beetle 7 LTR 1 TAACTAGCTCGGTTTGTCC CACTCCCCTAAGTCTTTCC 296
Beetle 3 RT 2 AGGGGATGAATGGAAGACG GAAACTAATCTCTCCTTGC 289
Bongo 3 LTR 3 ATTTGCTTGTATGCTACATG TTATTGTCCAACTCTAGACG 467
Bongo 3 RT 4 AAGAACAAGTACCCTTTGCC GAGAACTTGGCATATAATTG 368
Bingo 1 LTR 5 AAGGGCAACGGTCACTGGC TTACAAGATAGGTTCAAGGC 246
Bingo 1 RT 6 CGAAGATGCTCACAAAACGGC GCACTATACACAAGAATATCG 177
Beon 1 LTR 7 CACAAACATGAGATGGTGC CGGACTACTAGACAAGGC 373
Beon 1 RT 8 ATGAATAAAATCTTCCAGCC CCTAAGAAAGACACCTCG 191
  1. Abbreviations: LTR, long terminal repeat; PBS, primer binding site; PPT, polypurine tractRT, reverse transcriptase.