Skip to main content

Table 2 Primers and probes used for quantitative real-time PCR.

From: Reliable transgene-independent method for determining Sleeping Beauty transposon copy numbers

Primer/probe name Sequence 5'→3'
RPPH1  
   Forward AGCTGAGTGCGTCCTGTCACT
   Reverse TCTGGCCCTAGTCTCAGACCTT
   Probe CACTCCCATGTCCC
GFP  
   Forward GAGCGCACCATCTTCTTCAAG
   Reverse TGTCGCCCTCGAACTTCAC
   Probe ACGACGGCAACTACA
IRDR-L  
   Forward CTCGTTTTTCAACTACTCCACAAATTTCT
   Reverse GTGTCATGCACAAAGTAGATGTCCTA
   Probe CTGACTTGCCAAAACT
IRDR-R  
   Forward GCTGAAATGAATCATTCTCTCTACTATTATTCTGA
   Reverse AATTCCCTGTCTTAGGTCAGTTAGGA
   Probe TCACCACTTTATTTTAAGAATGTG